
Thermo Scientific™ Oligo(dT)18 Primers

Thermo Scientific™ Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5'- and 3'-hydroxyl ends. 120 UL OLIGO(DT)18 PRIMER, 100µM 120µL STORE AT-20°C

Thermo Scientific™ Primers for cDNA Synthesis

Optimze cDNA synthesis with these random hexamer primers, oligo(dT)18 primers and anchored oligo dT primers. 120 UL RANDOM HEXAMER PRIMER, 100µM 120µL STOREat -20°C

Thermo Scientific™ M13/pUC sequencing primer (-20), 17-mer

Accurately sequence DNA with M13 pUC sequencing primers, single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. 6 NMOL M13/PUC SEQUENCING PRIMER (-20), 17-MER,5'-d(GTAAAACGACGGCCAGT)-3', 10µm, 6nmol Store at

Thermo Scientific™ M13/pUC reverse sequencing primer (-26), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19-based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC REVERSE SEQUENCING PRIMER (-26),17-mer 5'-d(CAGGAAACAGCTATGAC)-3', 10µm, 6nmol

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 24-MER 10UM 4.2NMOL

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 24-MER 10UM 4.2NMOL

Thermo Scientific™ M13/pUC sequencing primer (-46), 22-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC PRIM -46 10UM 4.5NMOL

Thermo Scientific™ M13/pUC sequencing primer (-40), 17-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. 6 NMOL M13/PUC SEQUENCING PRIMER (-40), 17-MER,5'-d(GTTTTCCCAGTCACGAC)-3', 10µm, 6nmol Store at

Thermo Scientific™ Exo-Resistant Random Primer

Perform highly efficient random priming of DNA synthesis reactions with this mixture of single-stranded random oligonucleotides. 100 UL EXO-RESISTANT RANDOM PRIMER, 5'-NPNPNPNPNPSNpSN-3', 500µm 100µL Store at -20°C

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. SP6 PRIM 18-MER 10UM 5.6 NMOL

Thermo Scientific™ M13/pUC reverse sequencing primer (-46), 24-mer

Sequence DNA fragments inserted into the MCS of various pUC19 based cloning vectors with M13 pUC sequencing primers, single-stranded oligonucleotides. M13/PUC REV -46 10UM 4.2NMOL

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T3 PRIMER 17-MER 10UM 6NMOL

GE Healthcare RNA Homopolymers

Template primers POLY (A) 100 MG

GE Healthcare RNA Homopolymers

Template primers POLY (A) 500 MG
