missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10384680

Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer

Product Code. 10384680 Shop All Thermo Scientific Products
Change view
Click to view available options
Quantity:
10 μM, 45 μL
Unit Size:
Each
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Product Code. Quantity unitSize
10384680 10 μM, 45 μL Each
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
This item is not returnable. View return policy
Product Code. 10384680 Supplier Thermo Scientific™ Supplier No. SO114

Please to purchase this item. Need a web account? Register with us today!

41.76 EUR valid until 2026-04-10
BEST PRICE on Promo! Use promo code "27964" to get your promotional price.
This item is not returnable. View return policy

Description

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

TRUSTED_SUSTAINABILITY

Spezifikation

Product Type Sequencing Primer
Content And Storage M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer M13
Quantity 10 μM, 45 μL
Vector pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Name des Produkts
Wählen Sie ein Thema

Indem Sie auf Absenden klicken, erklären Sie sich damit einverstanden, dass Fisher Scientific sich mit Ihnen in Verbindung setzen kann, um Ihr Feedback in diesem Formular zu bearbeiten. Wir werden Ihre Informationen nicht für andere Zwecke weitergeben. Alle bereitgestellten Kontaktinformationen werden in Übereinstimmung mit unserer Datenschutzrichtlinie aufbewahrt. Datenschutzrichtlinie.