missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. 10756231

Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer

Product Code. 10756231 Shop All Thermo Scientific Products
Click to view available options
Quantity:
10 μM, 42 μL
Unit Size:
Each
This item is not returnable. View return policy

Product Code. 10756231

Brand: Thermo Scientific™ SO115

Please to purchase this item. Need a web account? Register with us today!

35.40 EUR valid until 2025-12-19
BEST PRICE on Promo! Use promo code "24110" to get your promotional price.
This item is not returnable. View return policy

Description

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'

TRUSTED_SUSTAINABILITY

Specifications

Product Type Sequencing Primer
Content And Storage M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer M13
Quantity 10 μM, 42 μL
Vector pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.

Product Content Correction

Your input is important to us. Please complete this form to provide feedback related to the content on this product.

Product Title

By clicking Submit, you acknowledge that you may be contacted by Fisher Scientific in regards to the feedback you have provided in this form. We will not share your information for any other purposes. All contact information provided shall also be maintained in accordance with our Privacy Policy.

Thank You! Your feedback has been submitted. Fisher Scientific is always working to improve our content for you. We appreciate your feedback.