Learn More
Thermo Scientific™ M13/pUC Reverse Sequencing Primer (-46), 24-mer
Shop All Thermo Scientific ProductsDescription
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'
Specifications
Specifications
| Product Type | Sequencing Primer |
| Content And Storage | M13/pUC Reverse Sequencing Primer (-46), 24-mer, 10 μM (42 μL) Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentration | 10 μM |
| Primer | M13 |
| Quantity | 10 μM, 42 μL |
| Vector | pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II |
| For Use With (Application) | Sequencing |
| Form | Liquid |
For Research Use Only. Not for use in diagnostic procedures.
Your input is important to us. Please complete this form to provide feedback related to the content on this product.