Offers equal performance to the DyNAmo Flash Probe qPCR Kit. In addition, it incorporates an innovative multicolor system that ensures correct pipetting. 40 RXN DYNAMO COLORFLASH PROBE QPCR KIT 2X BLUEMmix, contains Hot-Start Polymerase, PCR buffer,

Thermowell GOLD tubes fit automated equipment as well as the original manufacturers' tubes X1000 PCR tube, Thermowell GOLD 0.2mL, PP, Domed Cap, Natural, NonSterile, 500/bag

With integral “snap shut” cap X1000 PCR tube 0.2ml, domed cap, PP, yellowFB-0337/Y

Perform efficient synthesis of full-length first strand cDNA up to 13 kb with this genetically modified M-MuLV RT for routine reverse transcription. REVERTAID RT 200U/UL 10000U

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR tube 0.2ml, no cap, PP, green -FB-0264/G

Purify mRNA from total RNA samples with oligo (dT) poly A+-binding magnetic beads with up to 10-fold enrichment from 5-100 μg RNA input Hybrid. Buf/mRNA Kit

Ready-to-use qPCR master mixes with premixed UDG optimized for probe detection using standard cycling protocol. Master mixes available with or without blue color. 500RXN Luminaris Probe L ROX qPCR Master Mix

96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMO-FAST 96 PCR PLATElettering (White), 25 plates

With integral “snap shut” cap X1000 PCR tube 0.5ml, flat cap, PP, greenFB-0350G

Mastercycler pro + Control Panel, 230V, GB plug

Eliminate tedious oil or wax overlays with the thin-walled Thermo Scientific™ HotStart™ Storage Reaction Tubes. X480 MICROTUBES HOTSTART HOTSTART MICRO 50 WITHwax bead DNase and RNase free polypropylene for

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial. Fisherbrand™ Anodized Dual Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
DUAL BLOCK 96 WELL MICROTITER PLATEor 4 slides corosion resistant anodised aluminium

Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X250 STRIP 8X0,2ML CAP DOMED GREENStrips)

Optimize qPCR with probe chemistry using standard cycling protocols with these ready-to-use qPCR master mixes. MAXIMA PROBE QPCR 4X12.5ML

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PLATE PCR 96 WH WELLS BLE

ThermoMixer F0.5 w/thermoblock 24x0,5ml, EU

Contains a modified Thermus brockianus DNA polymerase and all the other reagents needed for qPCR. 1 SET DYNAMO HS SYBR GREEN QPCR KIT, 2X MASTERMix contains Hot-Start DNA Polymerase, SYBRGreen

96-well semi-skirted PCR plates with a flat deck for improved sealing in PCR and qPCR applications. X25 SEMI-SKIRTED 96, BARCODED, WHITE, 25 ST.

Get higher sensitivity, longer PCR products and higher yields in all standard PCR applications with this enhanced Taq DNA polymerase. X5 DREAMTAQ DNA POL 5U/UL 500U

Incorporates an inert blue dye to significantly enhance the contrast between reagent and plastic, making verification of master mix dispensing quick, easy, and foolproof. 1600RXN ABSOLUTE BLUE SYBR GREEN ROX1600 x 25µL reactions, 16 x 1.25mL vials store at

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 500RXN Luminaris HiGreen L ROX qPCR Master Mix

Mastercycler nexus 230 V/ 50-60 Hz

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Allows up to 100 cycles of amplification without loss of activity X100 UNITS TAQ DNA POLYMERASE, CONCENTRATION 5000units/mL

Available in full, half, and elevated skirt styles X50 PCR 96-Well plate, Thermowell GOLD, PP, Clear, Half Skirt, Nonsterile, 10/bag

96 WELL TEMPERATURE SENSOR PLATE, NOT ADJUSTED

Designed for single use PCR applications. Eppendorf™ PCR Tube Strips provide tight sealing to prevent evaporation in PCR, yet are easy to open. They ensure efficient heat transfer to the sample by virtue of their thin, even wall thickness and smooth wall surface. X120 PCR Tube 0,1ml and Cap, 8-Strip, flatVE=120 Stück

SuperScript™ IV VILO™ Master Mix is a reaction master mix designed for fast, sensitive, and reproducible cDNA synthesis in RT-qPCR applications. ezDNase

Fluorescence intensity up to ten times higher than with frosted wells x20 twintec real-time PCR 384, Black

Mastercycler nexus GSX1, 230 V