Molecular Biology Reagents and Kits

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix, High ROX

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen High ROX qPCRMastermix

Fisherbrand™ Anodized Aluminum Blocks

Useful for a variety of applications in molecular biology, histology, clinical, environmental and industrial settings. Fisherbrand™ Anodized Aluminum Blocks are for use with Fisherbrand Digital Block Heaters.
BLOCK 20 TUBES 10MM

Thermo Scientific™ 96-Well Semi-Skirted Plates, Flat Deck

96-well semi-skirted PCR plates with a flat deck for improved sealing in PCR and qPCR applications. X25 THERMO-FAST 96 PCR DET PLATE 25 plates

Thermo Scientific™ 0.2 mL Strip Tubes

Optimize PCR and qPCR with these 0.2 mL strip tubes, available as 8 tubes per strip in several colors or 12 tubes per strip. X120 STRIP 8X0,2ML DOMED REDpacks of 12

Thermo Scientific™ ABgene™ Thermo-Fast™ Robotic 96-Well Low Profile PCR Plates

96-well full-skirted SuperPlate which provides 4x more rigidity for superior robotic handling in PCR and qPCR applications. X50 THERMOFAST 96 LP ROBOTIC

Thermo Scientific™ 5-Fluoroorotic Acid

Detect expression of the URA3 gene, which encodes orotine-5'-monophosphate (OMP) dicarboxylase with Thermo Scientific™ 5-Fluoroorotic Acid, used in yeast molecular genetics. 1GR 5-FLUOROOROTIC ACID, >98% PURITY BY HPLCpowder 1g Store at -20°C

Thermo Scientific™ Armadillo™ 384-Well PCR Plates

Optimize high throughput robotic PCR and qPCR applications with these uItra-rigid 384-well PCR plates with poylcarbonate frames and polypropylene wells. X50 PLATE PCR 384 CLR WELLS GRN

Fisherbrand™ 96-Well Low-Profile, Skirted PCR Plates

Fit most thermal cyclers X25 Fisherbrand PCR plate 96-wells, full skirt, PP, natural - FB-0800

Thermo Scientific™ Armadillo™ 96-Well PCR Plate

Optimize robotic applications with these ultra-rigid 96-well PCR plates with U-bottom wells, available in various colors. X25 PCR HARDSHELL PLATE THERMO SCIENTIFIC 96 WELL25 plates

Eppendorf™ 0.5 Model ThermoMixer™

ThermoMixer F0.5 w/thermoblock 24x0,5ml, EU

Water, Molecular Biology Grade, Fisher BioReagents

Chemical Name or Material: Water Name Note: 0.03μm filtered to ensure high purity CAS: 7732-18-5 Purity Grade: Molecular Biology Grade Purity Grade Notes: DNase-, RNase- and Protease-Free Physical Form: Liquid Molecular Formula: H2O Formula Weight: 18.02 10LT Water, Molecular Biology Grade (Sterile-Filtered)

Thermo Scientific™ 96-Well Non-Skirted Plates, Low Profile

Low profile 96-well plates for use in PCR and qPCR applications. X25 THERMOFAST LP 96X0,2ML REDProfile, red, 25 plates

Alfa Aesar™ Fast Green FCF, Electrophoresis Reagent

100GR Fast Green FCF, Electrophoresis Reagent 100

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 5000RXN Luminaris Color HiGreen qPCR MM (2x)

Thermo Scientific™ DyNAmo Flash SYBR™ Green qPCR Kit

Developed for fast real-time qPCR, the kit provides qPCR results faster than most SYBR Green kits without compromising the qPCR performance. 2500 RXN DYNAMO FLASH SYBR GREEN QPCR KIT, 2 Xmaster mix contains Hot-Start DNA polymerase,

Thermo Scientific™ ABgene™ EasyStrip PCR Tubes

Each tube in the strip has an individually sealable cap to reduce the chance of sample contamination. PCR and QPCR setup and analysis are made much simpler with the unique design of these new tubes. EASYSTRIP SNAP TUBE NATURAL TUBE

Fisherbrand™ 0.2mL PCR Tube Strips

Ideal for use in 0.2mL, 96-well V-bottom thermal cyclers X250 PCR tube 0.2ml, no cap, PP, green -FB-0264/G

Thermo Scientific™ Pierce™ Agarose

Ensure uniform lot-to-lot consistency in preparing electrophoresis gels using highly purified and blended regular- or low-melting agarose formulations. AGAROSE II(LOW MELT)100GM

Water, for molecular biology, DNAse, RNAse and Protease free, ACROS Organics™

Chemical Name or Material: Water Name Note: DNase, RNase, Protease free CAS: 7732-18-5 Purity Grade: For molecular biology Molecular Formula: H2O Linear Formula: H2O Formula Weight: 18.02 MDL Number: MFCD00011332 1LT Water, for molecular biology, DNAse, RNAse and Protease free

Thermo Scientific Pierce™ D-Luciferin

Get convenience and high performance at a low cost in firefly luciferase reporter assays with our D-Luciferin, formulated at greater than 99% purity as both monosodium and monopotassium salts. 1GR D-LUCIFERIN, MONOPOTASSIUM SALT

Thermo Scientific™ Thermo-Fast™ 96-Well Full-Skirted Plates

96-well full-skirted PCR automation compatible plate for use in PCR and qPCR applications. X25 THERMOFAST SK 96X0,2ML GREENgreen (VE=25Stck.)

Thermo Scientific™ ABsolute™ Blue qPCR Mix, SYBR Green, With Separate ROX Vial

Incorporates an inert blue dye to significantly enhance the contrast between reagent and plastic, making verification of master mix dispensing quick, easy, and foolproof. 400RXN ABSOLUTE BLUE QPCR SYBR GREENROX vial, 400 x 25µL reactions, supplied in 1 x

Thermo Scientific™ DEPC-treated Water

X5 Molecular biology reagents, DEPC-treated water

Thermo Scientific™ 96-Well Non-Skirted Plates

96-well non-skirted plates for use in PCR and qPCR applications. Available with black lettering for improved sample tracking during pipetting. X25 THERMOFAST 96X0,2ML BLACK(VE=25Stck.)

Thermo Scientific™ pJET1.2 Sequencing Primers

Primers for sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2 and for colony screening by PCR. PJET1.2 REVERSE SEQUENCING PRIMER, 24-MER, 5'-D(AAGAACATCGATTTTCCATGGCAG)-3', 10µm, 8.4nmol Store

Thermo Scientific™ Maxima SYBR Green/Fluorescein qPCR Master Mix (2X)

Ready-to-use solution optimized for qPCR and 2-step RT-qPCR. X2 qPCR, Maxima(R) SYBR green/Fluorescein qPCR

Thermo Scientific™ Maxima™ Probe 2X qPCR Master Mix with ROX Solution

Optimize qPCR with probe chemistry using standard cycling protocols with these ready-to-use qPCR master mixes. X10 qPCR, Maxima(R) probe qPCR master mix, ROX

Thermo Scientific™ Luminaris Color HiGreen qPCR Master Mix, Fluorescein

Thermo Scientific Luminaris Color HiGreen and Luminaris HiGreen qPCR Master Mixes are universal ready-to-use solutions optimized for qPCR and two-step RT-qPCR. 250RXN Luminaris Color HiGreen Fluorescein qPCRMastermix

Thermo Scientific™ Transcription Promoter Sequencing Primers

Perform sequencing of DNA fragments located downstream from the corresponding RNA polymerase promoter sequences in cloning vectors, such as pTZ19R, pTZ57R and pBluescript II. T7 PRIMER 20-MER 10UM 5NMOL

Thermo Scientific™ Nuclease-free Water

X4 Molecular biology reagents, water, nuclease-fre

  spinner